October 26th notes

Discussion: implications of research in paper for other research questions
This paper: Discussion of Phage-R
• History of this experiment
• Luria and Delburick in discussion
• Implications for antibiotics resistance
• Treating bacterial infections with Phages? Disadvatages, Advantages
General Pointer: Start with material reader will most likely know and care about Start board and lead to narrow statement in paper.(boardest statement  become more detailed as background progresses  narrow statement: hypothesis. Bacteria cause illness. Is there anything that can make bacteria ill? Phages are viruses that can make bacteria ill. Example from class.
Mean number of t-4 resistant colonies/plate divided by number of bacteria in 0.1mL total – from serial dilution
II)
a. Supercoiled: coiled and coiled and coiled more
b. Double-stranded with antiparallel strands – double helixes
- DNA: sugar phosphate backbone attached to bases madfe out of deoxiribose and phosphates between the deoxiribose sugars
Carbon 5’ -PO4- -PO4- -PO4- 3’Carbon
A C G T
|| ||| ||| ||
T G C A
Carbon 3’  -PO4- -PO4- -PO4- 5’ Carbon
Semiconservative replication. one strand becomes two which becomes 4 only one is the original.
c. Complementary base-pairing  semiconservative replication – bind in a complementary basis and hook together is a sugar-phosphate backbone.
3.
a. Bacterial Circular chromosome is supercoiled. For DNA replication to begin, somewhere it must be unwound and unzipped this = oriC(origin of chromosome replication.) – part of the chromosome where replication will start. The easier to unzip the faster replication occurs. Easiest to unzip A and T easier to detach a and t from each than it is to detach c and g.
- At ori C site enzymes will bind to DNA
- DNA A protein enzyme that attaches to oriC on DNA
- DNA A brings in a DNA B
- DNA B helicase which is an enzymes that is going to uncoil the supercoils of the DNA
b. Helicase uncoils supercoils around oriC site, unzips DNA double strands
- Primase  enzyme that synthesizes small swatch of RNA complementary to part of oriC sequence.
- Primase attaches to unzipped DNA, synthesizes RNA primer.
c. DNA polymerase can now come in and start synthesizing our new DNA needs RNA primer sequence for it to attach to. Cant start up till the point at which where the RNA primer finishes. (DNA polymerase attaches to RNA primer, synthesizes DNA (DNA polymearase brings in bases complementary to bases on single template strand (starnd being copied), hooks new bases, into chain with sugar-phosphate backbone))
- DNA polymerase used here can only move in a 5’ to 3’ direction.
Summary from last class:
A) oRi C  where replication begins, lots A&T
• DNA A ezyme binds, recruits helicase
• Helicase winds, unzips DNA strands
B) Primase synthesizes swatch of RNA complementary to bit of DNA – this will allow DNA polymerase to bind to DNA strand, start copying
• Single strand binding protein attaches to unzipped strands to prevent re-annealing.
C) DNA polymerase synthesizes a new strand of DNA that complementary to template strand, moving in 5’  3’ direction
d. One strand synthesized continuously, but opposite strand not - Okazaki fragments on lagging strand. Fragments patched together with DNA ligase
e. DNA replication enzyme sets are moving in opposite directions around our circular Chromosome (meeting point is the terminus site  stops DNA replication) enzymes fall off the DNA
f. Interlocked complete circles must be detached (Decatenation – un-interlocking of circular Chromosomes)
- Done by two enzymes: DNA gyrase and topoisomerase IV(target of Cipro and other quinolone abx
- DNA methylated: Methyl groups are attached to some of the bases in the DNA particularly As and Ts (last step and takes a while relative to other things occurring)
IV. Repair to errors in DNA Replication
a. Spontaneous mutation rate about 1 mutant base pair per 10 billion base pairs copied different from the original.
i. Size of bacterial genomes
- E. coli ~ 5 million (5x106) base-pairs(bps)
- S. aureus ~ 3 million bps
- Chlamydia trachomatis ~ 1 million bps
- Mycoplasma genitalium ~ 500,000 bps
• Microbes that can survive in nature tend to have larger genomes than do microbes that are reliant on a host. (microbes that can survive independently have more genes (and thus larger genomes with more bps) than microbes that need a host)
- Viruses have much more minimalist genomes than bacteria do because they rely on host to provide for them. Extreme example. Viruses have very small genomes because have few genes)
-
b. Mismatch Repair system
i. Find mismatched bases (identified by proofreading enzymes) (can identify bump formed by two mismatched base pairs. TG AC.
ii.
iii. Methylated DNA is older. Methylated side is identified. Endonuclase is cutting the single strand of DNA on the non-methylated strand on the side of the kinky bit.  Degrades stretch between cuts. Then DNA polymerase will synthesize new matching strand. Once paired properly again tension is released and kink is removed from the methylated strand.
How many mutant bacteria are there in a colony of 1 billion E. coli?
(1x109 E c.oli) x (5x106) = 5x1015 bps in colony/1x1010 = 5x105 or 500,000
V. Protection of the bacterial chromosome from degradation
a. MEthylation CH3 added to adenine and cytosines on bacteria chromosome as last DNA replication step
- Advatages: allows mismatch repair system to udetify old vs. new (i.e. “right” vs. “wrong”) DNA strands
- Allows identification of potential viral DNA
b. Restriction enzymes:
i. Enzymes that recongnize/bind to particular sequences of DNA bases in DNA strand. And break DNA strand there
Ex. 5’ ATCCCGCA 3’
5’ AGGACAACTTCAATCCCGCACATAGACCCTAC 3’
Restriction enzyme binds to underlined porton.
Out of this breaking get two smaller fragments of DNA
5’AGGGACAACTTCAATC 3’ 5’CCGCACTAGACCCTAC 3’
ii. Bacteria make lots of different restricition enzymes thatbind to/break DNA at lots of different sequences
iii. Make restriction enzymes because it’s a defense against viruses (viral infection)
iv. Viral DNA has no methylated groups. The bacteria DNA has sign like Passover over it that makes it so that the Restriction enzymes only attack the Viral DNA

Page tags: microbiology notes
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License