notes: nov 7th and 9th

Nov. 7th

Protection of bacterial chromosome

Methylation CH3 adenine and cytosines on bacterial chromosome as last DNA
replication step

Advantages:

1. Allows mismatch repair system to identify old vs new (i.e. right vs
wrong) DNA strands

2. Allows identification of potential viral DNA

Restriction enzymes:

1.They are enzymes that recognize (bind to) particular
sequences of a DNA bases in DNA strand and break DNA strand
there

a. Ex. 5’ATCCCGCA3’

i. AGGGACAACTTCAATCCCGCACATAGACCCTAC

¬_restriction enzyme binds to the polysaccharide
taking out that sugar phosphate

b. 5’AGGGACAACTTCAATCCCGCACATAGACCCTAC3’

c. 5’agggacaacttaatc3’

2. Bacteria make lots of different restriction enzymes that bind
to/break Dna at lots of different sequences

3. Defense against viral infection

Nov. 4th handout
(higher density turns on biofilms)
The amount of signaling molecules in ps.

DNA Protein
(the instructions (Buliding blocs of organism)
That make information)

DNA RNA—— Protein *Gene (congruent to ) DNA instructions for a
↑ particular protein
Transcription

I. Transcription: DNA RNA

a. Initiation  determining which bit of DNA will be copied to RNA

i. RNA polymerase: sigma Factors

1. Enzymes that copied DNA into RNA copy( RNA copy is single-
stranded complementary to one DNA strand)

2. RNA polymerase binds to promoter sequences on DNA

3. Sigma Factor(subunit) of RNA polymerase that binds to DNA
promoter sequences

a. Different sigma factors attach to different promoter
sequences

b. Different sigma factors expressed under different conditions

ii. Promoter sequence on DNA: where transcription initiation occurs, Where
DNA is unwound and unzipped so RNA copy can be made

1. “Lots of A’s and T unzips the genes”

2. Have lots of T&A (TATAAT—-like sequence at almost all
promoter sites)

a. (chapter 8.1)

3. While have common TATA-box sequence, also have variability in
surrounding bases

(Read Chapter 8*)

November 9, 2009

Review from last time:

1. Initiation: is the start of transcription

a. Start with promoter sequence: specific sequence of bases on DNA
that RNA polymerase attaches to…variablitly in promoter sequences
through some consensus

i. (underline)—> ↑ enzyme that makes RNA cope of DNA strand

b. Sigma factor: subunit of RNA polymerase most responsible for
enzyme attachment to DNA promoter sequence

i. There are different sigma factors that exit under different
circumstances

ii. Different sigma factors bind to different promoter regions on
the DNA

iii. Different Sigma factors, are themselves made in response to
different environmental conditions

1. V. fisheri (exapmle)

c. DNA must be unwound and unzipped before it can be transcribed

i. This is because single DNA strand serves as a template for
RNA copy

2. Elongation: RNA stand synthesized by paring complementary RNA bases
w/ DNA template strand and hooking those bases together w/ sugar phosphate
backbone

a. for RNA  sugar = ribose

---b.TATAATACCTACCCCACAGGGGCAACTTAGACCCTATT ----—-↑is the promoter sequence (bz the T’s and A’s)
c.TATAATACCCTACCCCACAGGGGCAACTTAGACCCTATT

GGGAUGGGGUGUCCCCGUUGUUGAA

f. GGGAUGGGGUGUCCCCGUUGUUGAATTTTCCCAAAA
i. DNA is folded to itself, because the bases are
complementary to itself (looks like a fold sticking up) — it is
called a hairpin loop

3. Termination : RNA polymerase reaches hairpin loop, can’t get past (b/c
rNA polymerase can only move along ssDNA so, RNA polymerase falls off DNA
starnd releasing new ssRNA
I. mRNA: single stranded RNA copy of DNA gene, will be translated to amino acid sequence
II. tRNA: transfer rNA involved in translation of mRNA to amino acid chain  has “clover leaf” structure:

I. s t RNA is also ss RNA, but that’s base –paired w/ itself
II. anitcoden ACG
a. 3 bases that can pair w/ sets of 3 bases on mRNA
III. Side that has amino acid attaced to it

rRNA: ribosomal RNA main component of ribosomes
ribosomes =where translation occurs
long lived
mmrna to amino acid is also long lived

Page tags: microbiology
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License