Notes: 11-9-2009

Microbiology – Notes: 11-9-2009

I. Transcription: DNA → RNA (process by which an RNA copy of a DNA original template is going to be bad)
-RNA polymerase: enzyme that makes RNA copy DNA strand
-Initiation: start of transcription
*Sigma factors/subunit: subunit of RNA polymerase → most responsible for enzyme attachment to DNA promoter sequence
~Difference sigma factors bind to different promoters
~Different sigma factors made in response to different environmental conditions
EX: V. fischeri chromosome genes– luciferierase gene for light (ATP breakdown for light); gene for DNA signaling molecule (HSL); gene for receptor of signaling molecule
-Sigma factor always on (normal conditions): bind to DNA for promoter region of HSL and HSL receptor in chromosome → initiate transcription from DNA to RNA (i.e. proteins)
*Promoter sequence on DNA: specific sequence of bases on DNA that RNA polymerase attaches to
~Variability in promoter sequences, though some consensus
~Where transcription starts
~RNA polymerase binds to promoter sequence (unwinds) → DNA must be unwound/unzipped before it can be transcribed
~Unzipped b/c single DNA strand serves as a template for RNA copy (similar to DNA replication)
~Binds here because of sigma factors → refer above
*Rifampin binds bacterial, but not eukaryotic or Archaeal, RNA polymerase
-Elongation: process by which RNA strand synthesized by pairing of complementary RNA bases with DNA template strand and hooking those bases together with sugar-phosphate backbone (sugar = Ribose)
*Differences between DNA/RNA bases:
-Sugar – deoxiribose vs. ribose
-T base v. U base
-GACCCGACATATAATACCCTACCCCACAGGGCAACTTAGACCTATTTCCAAAAA
DNA original strand (promoter = underlined)
-CCC beginning, not true beginning: RNA copy GGGAUGGGUGUCCCCGUUGAAUCUGGAUAA

-Termination: RNA polymerase reaches hairpin loop, cannot get past (because RNA polymerase can only move along single-stranded DNA); so RNA polymerase falls off DNA strand releasing new single-stranded RNA
*Hairpin loop: DNA strand that’s folded back on itself because complementary to self
*RNA cannot move past hairpin loop and falls off
*Now have messenger RNA

II. Kinds of RNA
*mRNA: messenger RNA
-Single-stranded RNA copy of DNA gene, will be translated to amino acid sequence
-Tend to be very short-lived, existing for a few seconds, if not actively being transcribed/translated
*tRNA: transfer RNA
-Involved in translation of mRNA to amino acid chain
-Cloverleaf structure: single-stranded RNA, but is base-paired with itself
-Side with amino acid attached; opposite side has Anticodon: 3 bases (e.g. ACG) that can pair with sets of 3 complementary bases on mRNA
-Fairly long-lived, existing in cell for days/weeks
*rRNA: ribosomal RNA
-Main thing ribosomes (sugar) are made out of
-Ribosomes = where translation occurs (enzyme)
-Fairly long-lived, existing in cell for days/weeks

Page tags: microbiology notes
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License