notes 11-9

1) Initiation: start of transcription
a) Promoter sequence: specific sequence of bases on DNA that RNA polymerase attaches to
b) RNA polymerase: enzyme that makes RNA copy of DNA strands
c) Sigma factor:subunit on RNA polymerase most responsible for enzyme attachment to DNA promoter sequence
• Different sigma factors bind to different promoters
• Different sigma factors produced in response to different environmental conditions
• DNA must be unwound, unzipped before it can be transcribed
• This is because single DNA strand serves as a template for RNA copy
2) Elongation: RNA strand synthesized by pairing complementary RNA bases with DNA template strand and hooking those bases together with sugar-phosphate backbone (RNA—- sugar=ribose)
• In RNA “T” switches to “U”
• GACCCGACATATAATACCCTACCCCACAGGGGCAACTTAGACCCTATT
GGGAUGGGGUGUCCCGUUGAAUCUGGGAUAA
DNA strand that’s folded back on itself because complementary to self= “hairpin loop”
3) Termination: RNA polymerase reaches hairpin loop, can’t get past (because RNA polymerase can only move along single-strand DNA) so,RNA polymerase falls off DNA strand, releasing new single stranded RNA
Kinds of RNA
1) mRNA: single stranded RNA copy of DNA gene, will be translated to amino acid sequence( short-lived)
2) tRNA: transfer RNA involved in translation of mRNA to amino acid chain
• “cloverleaf” structure: tRNA is also single stranded RNA, but that’s base-paired with itself
• Anticodon: 3 bases that can pair with sets of 3 bases on mRNA
3) rRNA: ribosomal RNA, main component of ribosomes
• ribosomes= where translation occurs

Page tags: melissa
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License