November 9th notes

1.) Initiation: Start of transcription promoter sequence: Specific sequence of bases on DNA that RNA polymerase attaches to. —>Variability in promoter sequences, though some consensus.
(RNA polymerase: enzyme that makes RNA copy of DNA strand.)
-Sigma Factor: Subunit of RNA polymerase most responsible for enzyme attachment to DNA promoter
* Different sigma factors bind to different promoters.
* Different sigma factors produced in response to different environmental conditions.
-DNA must be unwound and unzipped before it can be transcribed. -This is because single DNA strand severs as a template of RNA copy.

2.) Elongation: RNA strand synthesized by pairing complementary RNA bases with DNA template strands and hooking those bases together with sugar-phosphate back bone. (RNA -> Sugar = Ribose) Example of promoter sequence: TATAATACCCTACCCACAGGGGCAACTTAGACCCTATTTTTTTCCAAAAA - The first TATAATA is the promoter sequence because it is the group with the most T AND A'S. - - - *GGGAUGGGUGUCCCGUUGAAUCUGGGAUAA (RNA strand)

(Hair pin loop comes at the end of the DNA strand where its folded back on itself because complem. to self.

3.)Termination: RNA polymerase reaches hairpin loop, can't get past (b/c RNA polymerase can only move along ssDNA) So, RNA polymerase falls off DNA strand , releasing new ssRNA.

mRNA: Single stranded RNA copy of DNA gene, will be translated to amino acid sequences. They are very short lived. They exist in the cell for just a few seconds.

tRNA: Transfer RNA involved in translation of mRNA to amino acid chain (Clover leaf Structure) (side = + RNA is also ssRNA, but that's base-paired with itself.) (Bottom side= side that has amino acid attached.) (top = 3 bases that can pair with sets of 3 bases on mRNA - anticodon) - Very long lived.

rRNA: Ribosomal RNA- "our RNA" - Main component of ribosomes. Ribosomes = where translation occurs. -Very long lived.

JA

Page tags: microbiology
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License